Review



algorithms imagestudio lite li cor  (LI-COR)


Bioz Verified Symbol LI-COR is a verified supplier
Bioz Manufacturer Symbol LI-COR manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 98
      Buy from Supplier

    Structured Review

    LI-COR algorithms imagestudio lite li cor
    Algorithms Imagestudio Lite Li Cor, supplied by LI-COR, used in various techniques. Bioz Stars score: 98/100, based on 3831 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+imagestudio+lite+li+cor/Fc+IMAGE+STUDIO+SOFTWARE/pmc10696401__mmc1-24-219-222
    Average 98 stars, based on 3831 article reviews
    algorithms imagestudio lite li cor - by Bioz Stars, 2026-09
    98/100 stars

    Images

    Related Articles

    Recombinant:

    Article Title: Diverse gut pathogens exploit the host engulfment pathway via a conserved mechanism
    Article Snippet: Cat# BK035-S Plasmids and recombinant proteins pGEX-6P-2 (GST) GE Healthcare Cat# 28-9546-50 GST ELMO1 full-length (FL) Sayed et al., 2021(1) n/a GST ELMO1 CT (aa 482-727) This paper n/a GST SifA WT Sayed et al., 2021(1) n/a GST SifA L130D This paper n/a GST-IPGB1 This paper Cloned from FLAG-IPGB1 provided by Neil Alto, UT Dallas GST-IPGB2 This paper Cloned from FLAG-IPGB2 provided by Neil Alto, UT Dallas GST- MAP This paper Cloned from FLAG-Map provided by Neil Alto, UT Dallas pET-28a (His) Novagene Cat# 69864 His ELMO1 full-length (FL) This paper n/a His ELMO1 CT (aa 482-727) This paper n/a His ELMO1 K620D/K626D/K628D This paper n/a His SifA WT This paper n/a His SifA L130D This paper n/a S-4 His SifA M131D This paper n/a His SifA L130D/M131D This paper n/a FLAG ELMO1 (WT) Sayed et al., 2021(1, 2) n/a FLAG ELMO1 (K3D) This paper K620D; K626D; K628D Mutagenesis Primers Forward primer Reverse primer Mouse ELMO1 K620D/K626D/K628D 5'- tgttttgtttaagggcaccatcctcatccatatgag ggcagtcctttcccgtc-3' 5'- gacgggaaaggactgccctcatatggatgag gatggtgcccttaaacaaaaca-3' 5'- caaagcagtggtgacgggagatgactgccctc atatgaaag-3' 5'- ctttcatatgagggcagtcatctccc gtcaccactgctttg-3' SifA L130D 5'- ccgggcgatctttcatatcaaaataaagattccc catgacttcacagct-3' 5'- agctgtgaagtcatggggaatcttt attttgatatgaaagatcgcccgg3' SifA M131D 5'- ttaaaatatccgggcgatctttatcatcaaaata aagattccccatgacttcacagc-3' 5'- gctgtgaagtcatggggaatctttat tttgatgataaagatcgcccggata ttttaa-3' Cloning Primers Forward primer (5’à3’) Reverse primer (5’à3’) Elmo1FL Elmo1 CT (BamHI/Not1) cgcggatccatgcaggtggtgaaggagcagg gcgacgcggccgctgttacagtca tagacaaagtcatagttgctaggtt cct IPGB1 (KpnI/BamHI) catggtaccatgcaaattctaaacaaaatacttccacaggt cgcggatccttaatttgtattgctttga cggtatacagcctt IPGB2 (KpnI/BamHI) catggtaccatgcttggaacatcttttaataattttggaatcagt cgcggatcctcagaaaggcgattc taaatttgtaatatagtcac MAP (EcoRI/KpnI) ccggaattccatgtttagtccaatgacaatggcagg catggtaccctacaatcgggtatcc tgtacatgctc Software and algorithms ImageStudio Lite LI-COR https://www.licor.com/bio/i mage-studio-lite/ Prism GraphPad Home - GraphPad PyMOL Molecular Graphics System https://pymol.org/2 ShinyGO v0.76 http://bioinformatics.sdstate.edu/go/ Codes for the construction and analysis of the PPI networks https://github.com/sinha72 90/ELMO Publicly deposited structures and/or datasets ELMO1 (PH domain) PDB:2VSZ https://www.rcsb.org/structure/2VSZ SKIP-PH bound to SifA PDB:3CXB https://www.rcsb.org/structure/3CXB DOCK2-bound to ELMO1 PDB:3A98 https://www.rcsb.org/structure/3A98 Proximity ligation assay (BioID) SifA interactome D’Costa VM et al.,(3) S-5

    Clone Assay:

    Article Title: Diverse gut pathogens exploit the host engulfment pathway via a conserved mechanism
    Article Snippet: Cat# BK035-S Plasmids and recombinant proteins pGEX-6P-2 (GST) GE Healthcare Cat# 28-9546-50 GST ELMO1 full-length (FL) Sayed et al., 2021(1) n/a GST ELMO1 CT (aa 482-727) This paper n/a GST SifA WT Sayed et al., 2021(1) n/a GST SifA L130D This paper n/a GST-IPGB1 This paper Cloned from FLAG-IPGB1 provided by Neil Alto, UT Dallas GST-IPGB2 This paper Cloned from FLAG-IPGB2 provided by Neil Alto, UT Dallas GST- MAP This paper Cloned from FLAG-Map provided by Neil Alto, UT Dallas pET-28a (His) Novagene Cat# 69864 His ELMO1 full-length (FL) This paper n/a His ELMO1 CT (aa 482-727) This paper n/a His ELMO1 K620D/K626D/K628D This paper n/a His SifA WT This paper n/a His SifA L130D This paper n/a S-4 His SifA M131D This paper n/a His SifA L130D/M131D This paper n/a FLAG ELMO1 (WT) Sayed et al., 2021(1, 2) n/a FLAG ELMO1 (K3D) This paper K620D; K626D; K628D Mutagenesis Primers Forward primer Reverse primer Mouse ELMO1 K620D/K626D/K628D 5'- tgttttgtttaagggcaccatcctcatccatatgag ggcagtcctttcccgtc-3' 5'- gacgggaaaggactgccctcatatggatgag gatggtgcccttaaacaaaaca-3' 5'- caaagcagtggtgacgggagatgactgccctc atatgaaag-3' 5'- ctttcatatgagggcagtcatctccc gtcaccactgctttg-3' SifA L130D 5'- ccgggcgatctttcatatcaaaataaagattccc catgacttcacagct-3' 5'- agctgtgaagtcatggggaatcttt attttgatatgaaagatcgcccgg3' SifA M131D 5'- ttaaaatatccgggcgatctttatcatcaaaata aagattccccatgacttcacagc-3' 5'- gctgtgaagtcatggggaatctttat tttgatgataaagatcgcccggata ttttaa-3' Cloning Primers Forward primer (5’à3’) Reverse primer (5’à3’) Elmo1FL Elmo1 CT (BamHI/Not1) cgcggatccatgcaggtggtgaaggagcagg gcgacgcggccgctgttacagtca tagacaaagtcatagttgctaggtt cct IPGB1 (KpnI/BamHI) catggtaccatgcaaattctaaacaaaatacttccacaggt cgcggatccttaatttgtattgctttga cggtatacagcctt IPGB2 (KpnI/BamHI) catggtaccatgcttggaacatcttttaataattttggaatcagt cgcggatcctcagaaaggcgattc taaatttgtaatatagtcac MAP (EcoRI/KpnI) ccggaattccatgtttagtccaatgacaatggcagg catggtaccctacaatcgggtatcc tgtacatgctc Software and algorithms ImageStudio Lite LI-COR https://www.licor.com/bio/i mage-studio-lite/ Prism GraphPad Home - GraphPad PyMOL Molecular Graphics System https://pymol.org/2 ShinyGO v0.76 http://bioinformatics.sdstate.edu/go/ Codes for the construction and analysis of the PPI networks https://github.com/sinha72 90/ELMO Publicly deposited structures and/or datasets ELMO1 (PH domain) PDB:2VSZ https://www.rcsb.org/structure/2VSZ SKIP-PH bound to SifA PDB:3CXB https://www.rcsb.org/structure/3CXB DOCK2-bound to ELMO1 PDB:3A98 https://www.rcsb.org/structure/3A98 Proximity ligation assay (BioID) SifA interactome D’Costa VM et al.,(3) S-5

    Mutagenesis:

    Article Title: Diverse gut pathogens exploit the host engulfment pathway via a conserved mechanism
    Article Snippet: Cat# BK035-S Plasmids and recombinant proteins pGEX-6P-2 (GST) GE Healthcare Cat# 28-9546-50 GST ELMO1 full-length (FL) Sayed et al., 2021(1) n/a GST ELMO1 CT (aa 482-727) This paper n/a GST SifA WT Sayed et al., 2021(1) n/a GST SifA L130D This paper n/a GST-IPGB1 This paper Cloned from FLAG-IPGB1 provided by Neil Alto, UT Dallas GST-IPGB2 This paper Cloned from FLAG-IPGB2 provided by Neil Alto, UT Dallas GST- MAP This paper Cloned from FLAG-Map provided by Neil Alto, UT Dallas pET-28a (His) Novagene Cat# 69864 His ELMO1 full-length (FL) This paper n/a His ELMO1 CT (aa 482-727) This paper n/a His ELMO1 K620D/K626D/K628D This paper n/a His SifA WT This paper n/a His SifA L130D This paper n/a S-4 His SifA M131D This paper n/a His SifA L130D/M131D This paper n/a FLAG ELMO1 (WT) Sayed et al., 2021(1, 2) n/a FLAG ELMO1 (K3D) This paper K620D; K626D; K628D Mutagenesis Primers Forward primer Reverse primer Mouse ELMO1 K620D/K626D/K628D 5'- tgttttgtttaagggcaccatcctcatccatatgag ggcagtcctttcccgtc-3' 5'- gacgggaaaggactgccctcatatggatgag gatggtgcccttaaacaaaaca-3' 5'- caaagcagtggtgacgggagatgactgccctc atatgaaag-3' 5'- ctttcatatgagggcagtcatctccc gtcaccactgctttg-3' SifA L130D 5'- ccgggcgatctttcatatcaaaataaagattccc catgacttcacagct-3' 5'- agctgtgaagtcatggggaatcttt attttgatatgaaagatcgcccgg3' SifA M131D 5'- ttaaaatatccgggcgatctttatcatcaaaata aagattccccatgacttcacagc-3' 5'- gctgtgaagtcatggggaatctttat tttgatgataaagatcgcccggata ttttaa-3' Cloning Primers Forward primer (5’à3’) Reverse primer (5’à3’) Elmo1FL Elmo1 CT (BamHI/Not1) cgcggatccatgcaggtggtgaaggagcagg gcgacgcggccgctgttacagtca tagacaaagtcatagttgctaggtt cct IPGB1 (KpnI/BamHI) catggtaccatgcaaattctaaacaaaatacttccacaggt cgcggatccttaatttgtattgctttga cggtatacagcctt IPGB2 (KpnI/BamHI) catggtaccatgcttggaacatcttttaataattttggaatcagt cgcggatcctcagaaaggcgattc taaatttgtaatatagtcac MAP (EcoRI/KpnI) ccggaattccatgtttagtccaatgacaatggcagg catggtaccctacaatcgggtatcc tgtacatgctc Software and algorithms ImageStudio Lite LI-COR https://www.licor.com/bio/i mage-studio-lite/ Prism GraphPad Home - GraphPad PyMOL Molecular Graphics System https://pymol.org/2 ShinyGO v0.76 http://bioinformatics.sdstate.edu/go/ Codes for the construction and analysis of the PPI networks https://github.com/sinha72 90/ELMO Publicly deposited structures and/or datasets ELMO1 (PH domain) PDB:2VSZ https://www.rcsb.org/structure/2VSZ SKIP-PH bound to SifA PDB:3CXB https://www.rcsb.org/structure/3CXB DOCK2-bound to ELMO1 PDB:3A98 https://www.rcsb.org/structure/3A98 Proximity ligation assay (BioID) SifA interactome D’Costa VM et al.,(3) S-5

    Cloning:

    Article Title: Diverse gut pathogens exploit the host engulfment pathway via a conserved mechanism
    Article Snippet: Cat# BK035-S Plasmids and recombinant proteins pGEX-6P-2 (GST) GE Healthcare Cat# 28-9546-50 GST ELMO1 full-length (FL) Sayed et al., 2021(1) n/a GST ELMO1 CT (aa 482-727) This paper n/a GST SifA WT Sayed et al., 2021(1) n/a GST SifA L130D This paper n/a GST-IPGB1 This paper Cloned from FLAG-IPGB1 provided by Neil Alto, UT Dallas GST-IPGB2 This paper Cloned from FLAG-IPGB2 provided by Neil Alto, UT Dallas GST- MAP This paper Cloned from FLAG-Map provided by Neil Alto, UT Dallas pET-28a (His) Novagene Cat# 69864 His ELMO1 full-length (FL) This paper n/a His ELMO1 CT (aa 482-727) This paper n/a His ELMO1 K620D/K626D/K628D This paper n/a His SifA WT This paper n/a His SifA L130D This paper n/a S-4 His SifA M131D This paper n/a His SifA L130D/M131D This paper n/a FLAG ELMO1 (WT) Sayed et al., 2021(1, 2) n/a FLAG ELMO1 (K3D) This paper K620D; K626D; K628D Mutagenesis Primers Forward primer Reverse primer Mouse ELMO1 K620D/K626D/K628D 5'- tgttttgtttaagggcaccatcctcatccatatgag ggcagtcctttcccgtc-3' 5'- gacgggaaaggactgccctcatatggatgag gatggtgcccttaaacaaaaca-3' 5'- caaagcagtggtgacgggagatgactgccctc atatgaaag-3' 5'- ctttcatatgagggcagtcatctccc gtcaccactgctttg-3' SifA L130D 5'- ccgggcgatctttcatatcaaaataaagattccc catgacttcacagct-3' 5'- agctgtgaagtcatggggaatcttt attttgatatgaaagatcgcccgg3' SifA M131D 5'- ttaaaatatccgggcgatctttatcatcaaaata aagattccccatgacttcacagc-3' 5'- gctgtgaagtcatggggaatctttat tttgatgataaagatcgcccggata ttttaa-3' Cloning Primers Forward primer (5’à3’) Reverse primer (5’à3’) Elmo1FL Elmo1 CT (BamHI/Not1) cgcggatccatgcaggtggtgaaggagcagg gcgacgcggccgctgttacagtca tagacaaagtcatagttgctaggtt cct IPGB1 (KpnI/BamHI) catggtaccatgcaaattctaaacaaaatacttccacaggt cgcggatccttaatttgtattgctttga cggtatacagcctt IPGB2 (KpnI/BamHI) catggtaccatgcttggaacatcttttaataattttggaatcagt cgcggatcctcagaaaggcgattc taaatttgtaatatagtcac MAP (EcoRI/KpnI) ccggaattccatgtttagtccaatgacaatggcagg catggtaccctacaatcgggtatcc tgtacatgctc Software and algorithms ImageStudio Lite LI-COR https://www.licor.com/bio/i mage-studio-lite/ Prism GraphPad Home - GraphPad PyMOL Molecular Graphics System https://pymol.org/2 ShinyGO v0.76 http://bioinformatics.sdstate.edu/go/ Codes for the construction and analysis of the PPI networks https://github.com/sinha72 90/ELMO Publicly deposited structures and/or datasets ELMO1 (PH domain) PDB:2VSZ https://www.rcsb.org/structure/2VSZ SKIP-PH bound to SifA PDB:3CXB https://www.rcsb.org/structure/3CXB DOCK2-bound to ELMO1 PDB:3A98 https://www.rcsb.org/structure/3A98 Proximity ligation assay (BioID) SifA interactome D’Costa VM et al.,(3) S-5

    Software:

    Article Title: Diverse gut pathogens exploit the host engulfment pathway via a conserved mechanism
    Article Snippet: Cat# BK035-S Plasmids and recombinant proteins pGEX-6P-2 (GST) GE Healthcare Cat# 28-9546-50 GST ELMO1 full-length (FL) Sayed et al., 2021(1) n/a GST ELMO1 CT (aa 482-727) This paper n/a GST SifA WT Sayed et al., 2021(1) n/a GST SifA L130D This paper n/a GST-IPGB1 This paper Cloned from FLAG-IPGB1 provided by Neil Alto, UT Dallas GST-IPGB2 This paper Cloned from FLAG-IPGB2 provided by Neil Alto, UT Dallas GST- MAP This paper Cloned from FLAG-Map provided by Neil Alto, UT Dallas pET-28a (His) Novagene Cat# 69864 His ELMO1 full-length (FL) This paper n/a His ELMO1 CT (aa 482-727) This paper n/a His ELMO1 K620D/K626D/K628D This paper n/a His SifA WT This paper n/a His SifA L130D This paper n/a S-4 His SifA M131D This paper n/a His SifA L130D/M131D This paper n/a FLAG ELMO1 (WT) Sayed et al., 2021(1, 2) n/a FLAG ELMO1 (K3D) This paper K620D; K626D; K628D Mutagenesis Primers Forward primer Reverse primer Mouse ELMO1 K620D/K626D/K628D 5'- tgttttgtttaagggcaccatcctcatccatatgag ggcagtcctttcccgtc-3' 5'- gacgggaaaggactgccctcatatggatgag gatggtgcccttaaacaaaaca-3' 5'- caaagcagtggtgacgggagatgactgccctc atatgaaag-3' 5'- ctttcatatgagggcagtcatctccc gtcaccactgctttg-3' SifA L130D 5'- ccgggcgatctttcatatcaaaataaagattccc catgacttcacagct-3' 5'- agctgtgaagtcatggggaatcttt attttgatatgaaagatcgcccgg3' SifA M131D 5'- ttaaaatatccgggcgatctttatcatcaaaata aagattccccatgacttcacagc-3' 5'- gctgtgaagtcatggggaatctttat tttgatgataaagatcgcccggata ttttaa-3' Cloning Primers Forward primer (5’à3’) Reverse primer (5’à3’) Elmo1FL Elmo1 CT (BamHI/Not1) cgcggatccatgcaggtggtgaaggagcagg gcgacgcggccgctgttacagtca tagacaaagtcatagttgctaggtt cct IPGB1 (KpnI/BamHI) catggtaccatgcaaattctaaacaaaatacttccacaggt cgcggatccttaatttgtattgctttga cggtatacagcctt IPGB2 (KpnI/BamHI) catggtaccatgcttggaacatcttttaataattttggaatcagt cgcggatcctcagaaaggcgattc taaatttgtaatatagtcac MAP (EcoRI/KpnI) ccggaattccatgtttagtccaatgacaatggcagg catggtaccctacaatcgggtatcc tgtacatgctc Software and algorithms ImageStudio Lite LI-COR https://www.licor.com/bio/i mage-studio-lite/ Prism GraphPad Home - GraphPad PyMOL Molecular Graphics System https://pymol.org/2 ShinyGO v0.76 http://bioinformatics.sdstate.edu/go/ Codes for the construction and analysis of the PPI networks https://github.com/sinha72 90/ELMO Publicly deposited structures and/or datasets ELMO1 (PH domain) PDB:2VSZ https://www.rcsb.org/structure/2VSZ SKIP-PH bound to SifA PDB:3CXB https://www.rcsb.org/structure/3CXB DOCK2-bound to ELMO1 PDB:3A98 https://www.rcsb.org/structure/3A98 Proximity ligation assay (BioID) SifA interactome D’Costa VM et al.,(3) S-5

    Protein-Protein interactions:

    Article Title: Diverse gut pathogens exploit the host engulfment pathway via a conserved mechanism
    Article Snippet: Cat# BK035-S Plasmids and recombinant proteins pGEX-6P-2 (GST) GE Healthcare Cat# 28-9546-50 GST ELMO1 full-length (FL) Sayed et al., 2021(1) n/a GST ELMO1 CT (aa 482-727) This paper n/a GST SifA WT Sayed et al., 2021(1) n/a GST SifA L130D This paper n/a GST-IPGB1 This paper Cloned from FLAG-IPGB1 provided by Neil Alto, UT Dallas GST-IPGB2 This paper Cloned from FLAG-IPGB2 provided by Neil Alto, UT Dallas GST- MAP This paper Cloned from FLAG-Map provided by Neil Alto, UT Dallas pET-28a (His) Novagene Cat# 69864 His ELMO1 full-length (FL) This paper n/a His ELMO1 CT (aa 482-727) This paper n/a His ELMO1 K620D/K626D/K628D This paper n/a His SifA WT This paper n/a His SifA L130D This paper n/a S-4 His SifA M131D This paper n/a His SifA L130D/M131D This paper n/a FLAG ELMO1 (WT) Sayed et al., 2021(1, 2) n/a FLAG ELMO1 (K3D) This paper K620D; K626D; K628D Mutagenesis Primers Forward primer Reverse primer Mouse ELMO1 K620D/K626D/K628D 5'- tgttttgtttaagggcaccatcctcatccatatgag ggcagtcctttcccgtc-3' 5'- gacgggaaaggactgccctcatatggatgag gatggtgcccttaaacaaaaca-3' 5'- caaagcagtggtgacgggagatgactgccctc atatgaaag-3' 5'- ctttcatatgagggcagtcatctccc gtcaccactgctttg-3' SifA L130D 5'- ccgggcgatctttcatatcaaaataaagattccc catgacttcacagct-3' 5'- agctgtgaagtcatggggaatcttt attttgatatgaaagatcgcccgg3' SifA M131D 5'- ttaaaatatccgggcgatctttatcatcaaaata aagattccccatgacttcacagc-3' 5'- gctgtgaagtcatggggaatctttat tttgatgataaagatcgcccggata ttttaa-3' Cloning Primers Forward primer (5’à3’) Reverse primer (5’à3’) Elmo1FL Elmo1 CT (BamHI/Not1) cgcggatccatgcaggtggtgaaggagcagg gcgacgcggccgctgttacagtca tagacaaagtcatagttgctaggtt cct IPGB1 (KpnI/BamHI) catggtaccatgcaaattctaaacaaaatacttccacaggt cgcggatccttaatttgtattgctttga cggtatacagcctt IPGB2 (KpnI/BamHI) catggtaccatgcttggaacatcttttaataattttggaatcagt cgcggatcctcagaaaggcgattc taaatttgtaatatagtcac MAP (EcoRI/KpnI) ccggaattccatgtttagtccaatgacaatggcagg catggtaccctacaatcgggtatcc tgtacatgctc Software and algorithms ImageStudio Lite LI-COR https://www.licor.com/bio/i mage-studio-lite/ Prism GraphPad Home - GraphPad PyMOL Molecular Graphics System https://pymol.org/2 ShinyGO v0.76 http://bioinformatics.sdstate.edu/go/ Codes for the construction and analysis of the PPI networks https://github.com/sinha72 90/ELMO Publicly deposited structures and/or datasets ELMO1 (PH domain) PDB:2VSZ https://www.rcsb.org/structure/2VSZ SKIP-PH bound to SifA PDB:3CXB https://www.rcsb.org/structure/3CXB DOCK2-bound to ELMO1 PDB:3A98 https://www.rcsb.org/structure/3A98 Proximity ligation assay (BioID) SifA interactome D’Costa VM et al.,(3) S-5

    Proximity Ligation Assay:

    Article Title: Diverse gut pathogens exploit the host engulfment pathway via a conserved mechanism
    Article Snippet: Cat# BK035-S Plasmids and recombinant proteins pGEX-6P-2 (GST) GE Healthcare Cat# 28-9546-50 GST ELMO1 full-length (FL) Sayed et al., 2021(1) n/a GST ELMO1 CT (aa 482-727) This paper n/a GST SifA WT Sayed et al., 2021(1) n/a GST SifA L130D This paper n/a GST-IPGB1 This paper Cloned from FLAG-IPGB1 provided by Neil Alto, UT Dallas GST-IPGB2 This paper Cloned from FLAG-IPGB2 provided by Neil Alto, UT Dallas GST- MAP This paper Cloned from FLAG-Map provided by Neil Alto, UT Dallas pET-28a (His) Novagene Cat# 69864 His ELMO1 full-length (FL) This paper n/a His ELMO1 CT (aa 482-727) This paper n/a His ELMO1 K620D/K626D/K628D This paper n/a His SifA WT This paper n/a His SifA L130D This paper n/a S-4 His SifA M131D This paper n/a His SifA L130D/M131D This paper n/a FLAG ELMO1 (WT) Sayed et al., 2021(1, 2) n/a FLAG ELMO1 (K3D) This paper K620D; K626D; K628D Mutagenesis Primers Forward primer Reverse primer Mouse ELMO1 K620D/K626D/K628D 5'- tgttttgtttaagggcaccatcctcatccatatgag ggcagtcctttcccgtc-3' 5'- gacgggaaaggactgccctcatatggatgag gatggtgcccttaaacaaaaca-3' 5'- caaagcagtggtgacgggagatgactgccctc atatgaaag-3' 5'- ctttcatatgagggcagtcatctccc gtcaccactgctttg-3' SifA L130D 5'- ccgggcgatctttcatatcaaaataaagattccc catgacttcacagct-3' 5'- agctgtgaagtcatggggaatcttt attttgatatgaaagatcgcccgg3' SifA M131D 5'- ttaaaatatccgggcgatctttatcatcaaaata aagattccccatgacttcacagc-3' 5'- gctgtgaagtcatggggaatctttat tttgatgataaagatcgcccggata ttttaa-3' Cloning Primers Forward primer (5’à3’) Reverse primer (5’à3’) Elmo1FL Elmo1 CT (BamHI/Not1) cgcggatccatgcaggtggtgaaggagcagg gcgacgcggccgctgttacagtca tagacaaagtcatagttgctaggtt cct IPGB1 (KpnI/BamHI) catggtaccatgcaaattctaaacaaaatacttccacaggt cgcggatccttaatttgtattgctttga cggtatacagcctt IPGB2 (KpnI/BamHI) catggtaccatgcttggaacatcttttaataattttggaatcagt cgcggatcctcagaaaggcgattc taaatttgtaatatagtcac MAP (EcoRI/KpnI) ccggaattccatgtttagtccaatgacaatggcagg catggtaccctacaatcgggtatcc tgtacatgctc Software and algorithms ImageStudio Lite LI-COR https://www.licor.com/bio/i mage-studio-lite/ Prism GraphPad Home - GraphPad PyMOL Molecular Graphics System https://pymol.org/2 ShinyGO v0.76 http://bioinformatics.sdstate.edu/go/ Codes for the construction and analysis of the PPI networks https://github.com/sinha72 90/ELMO Publicly deposited structures and/or datasets ELMO1 (PH domain) PDB:2VSZ https://www.rcsb.org/structure/2VSZ SKIP-PH bound to SifA PDB:3CXB https://www.rcsb.org/structure/3CXB DOCK2-bound to ELMO1 PDB:3A98 https://www.rcsb.org/structure/3A98 Proximity ligation assay (BioID) SifA interactome D’Costa VM et al.,(3) S-5



    Similar Products

    algorithms imagestudio lite li cor  (LI-COR)
    98
    LI-COR algorithms imagestudio lite li cor
    Algorithms Imagestudio Lite Li Cor, supplied by LI-COR, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+imagestudio+lite+li+cor/Fc+IMAGE+STUDIO+SOFTWARE/pmc10696401__mmc1-24-219-222
    Average 98 stars, based on 1 article reviews
    algorithms imagestudio lite li cor - by Bioz Stars, 2026-09
    98/100 stars
    		  Buy from Supplier

    Image Search Results